Methodological Framework for Investigating ER-Associated Protein Dynamics During Mitotic Progression
The following procedures describe the comprehensive experimental approaches utilized to investigate the structural and functional dynamics of endoplasmic reticulum (ER)-associated proteins throughout the cell cycle. For detailed insights into the regulatory mechanisms governing these cellular transitions, refer to established studies on mitotic progression and spindle assembly dynamics .
Cell Synchronization and Pharmacological Inhibition
To analyze cell cycle-dependent protein modifications, cells were synchronized using the following chemical agents. These protocols facilitate the precise assessment of protein status during specific mitotic transitions, often involving the use of small-molecule inhibitors such as roscovitine derivatives or related kinase modulators.
| Treatment Agent | Concentration | Target Phase/Function |
|---|---|---|
| Mimosine | 0.4 mM | Late G1 |
| Aphidicolin | 2 µg/mL | Early S |
| RO3306 | 10 µM | G2 / CDK1 inhibition |
| Nocodazole | 100 ng/mL | G2/M / Mitotic arrest |
| STLC | 10 µM | Prometaphase arrest |
| MLN8237 | 500 nM | Aurora kinase A |
| Barasertib | 10 µM | Aurora kinase B |
| BI 2536 | 100 nM | PLK1 |
| Dynarrestin | 50 µM | Dynein activity |
CRISPR/Cas9-Mediated Knockout Strategy
Knockout (KO) cell lines were generated targeting key reticulon proteins. The target oligonucleotides were synthesized and ligated into U6-sgRNA vectors for co-transfection with pSpCas9. Selection was performed using 2 µg/mL puromycin or 10 µg/mL blasticidin. Successful genome editing was confirmed via Western blot and sequencing.
| Target Gene | Sense Oligonucleotide (5’-3’) | Antisense Oligonucleotide (5’-3’) |
|---|---|---|
| RTN4 | GCGGGCACGGTCGACGACAC | CGTTCAAGTACCAGTTCGTG |
| RTN3 | GCGCGCCTTACCCGCACAGG | CTGTGCGGGTAAGGCGCGCG |
| REEP5 | GGAGCTTCATCGCTCTTGGT | CGGACTGGTGGCCTTGTACC |
Protein Expression and Immunodetection
For Western blotting and co-immunoprecipitation (co-IP) analysis, protein lysates were prepared in specialized buffers containing protease and phosphatase inhibitor cocktails. Proteins were separated via SDS-PAGE and transferred to PVDF membranes. Primary antibodies, including anti-Flag M2 (1:10000), anti-GAPDH (1:10000), anti-HA (1:5000), and anti-Reticulon4 (1:2000), were used for specific protein visualization. For co-IP, lysates were incubated with anti-Flag M2 affinity gels, anti-GFP nanobody agarose beads, or Strep-Tactin XT 4Flow resins.
Microscopy and Image Processing
Immunofluorescence samples were prepared using 4% paraformaldehyde fixation followed by 0.15% Triton X-100 permeabilization. High-resolution imaging was conducted using a Live SR CSU W1 spinning-disk confocal microscope or a Zeiss LSM980 in Airyscan mode. Live-cell imaging maintained physiological conditions (37°C, 5% CO2) using a Dragonfly high-speed spinning-disk system. Images were processed and analyzed using Imaris software or ImageJ, ensuring accurate representation of mitotic ER distribution and organelle positioning.