Methodological Framework for Investigating ER-Associated Protein Dynamics During Mitotic Progression

The following procedures describe the comprehensive experimental approaches utilized to investigate the structural and functional dynamics of endoplasmic reticulum (ER)-associated proteins throughout the cell cycle. For detailed insights into the regulatory mechanisms governing these cellular transitions, refer to established studies on mitotic progression and spindle assembly dynamics .

Cell Synchronization and Pharmacological Inhibition

To analyze cell cycle-dependent protein modifications, cells were synchronized using the following chemical agents. These protocols facilitate the precise assessment of protein status during specific mitotic transitions, often involving the use of small-molecule inhibitors such as roscovitine derivatives or related kinase modulators.

Treatment Agent Concentration Target Phase/Function
Mimosine 0.4 mM Late G1
Aphidicolin 2 µg/mL Early S
RO3306 10 µM G2 / CDK1 inhibition
Nocodazole 100 ng/mL G2/M / Mitotic arrest
STLC 10 µM Prometaphase arrest
MLN8237 500 nM Aurora kinase A
Barasertib 10 µM Aurora kinase B
BI 2536 100 nM PLK1
Dynarrestin 50 µM Dynein activity

CRISPR/Cas9-Mediated Knockout Strategy

Knockout (KO) cell lines were generated targeting key reticulon proteins. The target oligonucleotides were synthesized and ligated into U6-sgRNA vectors for co-transfection with pSpCas9. Selection was performed using 2 µg/mL puromycin or 10 µg/mL blasticidin. Successful genome editing was confirmed via Western blot and sequencing.

Target Gene Sense Oligonucleotide (5’-3’) Antisense Oligonucleotide (5’-3’)
RTN4 GCGGGCACGGTCGACGACAC CGTTCAAGTACCAGTTCGTG
RTN3 GCGCGCCTTACCCGCACAGG CTGTGCGGGTAAGGCGCGCG
REEP5 GGAGCTTCATCGCTCTTGGT CGGACTGGTGGCCTTGTACC

Protein Expression and Immunodetection

For Western blotting and co-immunoprecipitation (co-IP) analysis, protein lysates were prepared in specialized buffers containing protease and phosphatase inhibitor cocktails. Proteins were separated via SDS-PAGE and transferred to PVDF membranes. Primary antibodies, including anti-Flag M2 (1:10000), anti-GAPDH (1:10000), anti-HA (1:5000), and anti-Reticulon4 (1:2000), were used for specific protein visualization. For co-IP, lysates were incubated with anti-Flag M2 affinity gels, anti-GFP nanobody agarose beads, or Strep-Tactin XT 4Flow resins.

Microscopy and Image Processing

Immunofluorescence samples were prepared using 4% paraformaldehyde fixation followed by 0.15% Triton X-100 permeabilization. High-resolution imaging was conducted using a Live SR CSU W1 spinning-disk confocal microscope or a Zeiss LSM980 in Airyscan mode. Live-cell imaging maintained physiological conditions (37°C, 5% CO2) using a Dragonfly high-speed spinning-disk system. Images were processed and analyzed using Imaris software or ImageJ, ensuring accurate representation of mitotic ER distribution and organelle positioning.